dPCR Microbial DNA Detection Assay for Mycobacterium tuberculosis

GeneGlobe ID: DMA00221 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab verified
Product name​
Mycobacterium tuberculosis
GeneGlobe Cat.No. (Assay ID)​
DMA00221
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Mycobacterium tuberculosis (1773)
Bacillus tuberculosis
Bacterium tuberculosis
Mycobacterium tuberculosis typus humanus
Mycobacterium tuberculosis var. hominis
Mycobacterium tuberculosis (Zopf 1883) Lehmann and Neumann 1896 (Approved Lists 1980)
Template accession​
NC_002755.2
Taxonomy​
Bacteria
Secondary targets/specificity​
Mycobacterium canetti (78331)
Mycobacterium canettii
Application field​
Human Pathogens
Wet-lab tested in singleplex​
Yes, tested dye - HEX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GGGAGTGTTTGGGTTTTGTTTGGAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGGAAAGGTCTCTTCGGAGATACTCGAGTGGCGAACGGGTGAGTAACACGTGGGTGATCTGCCCTGCACTTCGGGATAAGCCTGGGAAACTGGGTCTAATACCGGATAGGACCACGGGATGCATGTCTTGTGGTGGAAA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 239.09 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Introducing the dPCR Microbial DNA Detection Assay for Mycobacterium tuberculosis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Mycobacterium canetti models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Mycobacterium tuberculosis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Mycobacterium canetti studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Mycobacterium tuberculosis and elevate your work to new heights.