dPCR Microbial DNA Detection Assay for Respiratory syncytial virus (1)

GeneGlobe ID: DMA00379 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay targeting the matrix protein gene
dPCR wet-lab verified
Product name​
Respiratory syncytial virus (1)
GeneGlobe Cat.No. (Assay ID)​
DMA00379
Target type​
Microbial Id
Target region​
Matrix protein gene
Target (NCBI taxonomy ID)​
Respiratory syncytial virus (12814)
respiratory syncytial virus RS
respiratory syncytial virus RSV
respiratory syncytial virus RS virus
RSV
Template accession​
KJ723482.1
Taxonomy​
Viruses
Application field​
Human Pathogens
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - HEX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
AAAAGAACAAGATGGGGCAAATATGGAAACATACGTGAACAAGCTTCACGAAGGCTCCACATACACAGCAGCTGTTCAGTACAATGTTCTAGAAAAAGATGATGATCCTGCATC
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 243.63 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Introducing the dPCR Microbial DNA Detection Assay for Respiratory syncytial virus (1), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Respiratory syncytial virus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Respiratory syncytial virus (1) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Respiratory syncytial virus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Respiratory syncytial virus (1) and elevate your work to new heights.