dPCR Microbial DNA Detection Assay for Norovirus GI

GeneGlobe ID: DMA00472 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay targeting the RNA-dependent RNA polymerase gene
dPCR wet-lab verified
Product name​
Norovirus GI
GeneGlobe Cat.No. (Assay ID)​
DMA00472
Target type​
Microbial Id
Target region​
RNA-dependent RNA polymerase gene
Target (NCBI taxonomy ID)​
Norovirus GI (122928)
Human calicivirus genogroup 1
Norovirus genogroup 1
Norovirus genogroup I
Norwalk-like virus genogroup 1
Template accession​
GU299761.1
Taxonomy​
Viruses
Application field​
Human Pathogens
Wet-lab tested in singleplex​
Yes, tested dye - HEX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TGGCAGGCCATGTTCCGCTGGATGCGATTCCATGACTTAAGTTTGTGGACAGGAGATCGCGATCTCTTGCCCGATTATGTAAATGATGATGGCGTCTAAGGACGCCCCAACAAACA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 231.72 KBLanguage: English

Resources

Available Product Catalog (2)
기술 정보 (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
키트 안내서 (1)
브로셔 및 가이드 (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Introducing the dPCR Microbial DNA Detection Assay for Norovirus GI, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Norovirus GI models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Norovirus GI facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Norovirus GI studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Norovirus GI and elevate your work to new heights.