dPCR Microbial DNA Detection Assay for Human Papillomavirus 16

GeneGlobe ID: DMA00882 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay
Alternative names of species: Human papilloma virus type 16, Human papillomavirus-16, Human papillomavirus type 16, human papillomavirus type 16, HPV 16, human papillomavirus type 16 HPV16
dPCR wet-lab verified
Product name​
Human Papillomavirus 16
GeneGlobe Cat.No. (Assay ID)​
DMA00882
Target type​
Microbial Id
Target region​
L1
Target (NCBI taxonomy ID)​
Human papillomavirus 16 (333760)
HPV16
Human papillomavirus - 16
Human papilloma virus type 16
Human papillomavirus type 16
human papillomavirus type 16 HPV 16
human papillomavirus type 16 HPV16
HPV-16
Template accession​
OQ911727.1
Taxonomy​
Viruses
Application field​
Human Pathogens
Infectious Diseases
Sexually Transmitted Infections (STI)
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
TATTGGTTACAACGAGCACAGGGCCACAATAATGGCATTTGTTGGGGTAACCAACTATTTGTTACTGTTGTTGATACTACACGCAGTACAAATATGTC
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Introducing the dPCR Microbial DNA Detection Assay for Human Papillomavirus 16, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Human papillomavirus 16 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Human Papillomavirus 16 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Human papillomavirus 16 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Human Papillomavirus 16 and elevate your work to new heights.