dPCR Microbial DNA Detection Assay for Pediococcus acidilactici

GeneGlobe ID: DMA00252 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name​
Pediococcus acidilactici
GeneGlobe Cat.No. (Assay ID)​
DMA00252
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Pediococcus acidilactici (1254)
Pediococcus acidilactici Lindner 1887 (Approved Lists 1980) emend. Judicial Commission 1996
Pediococcus lindneri
Pediococcus lolii
Template accession​
GQ421473.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Pediococcus pentosaceus (1255)
Pediococcus hennebergii
Application field​
Probiotics
Human Microbiome
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TAACACCTGGAAACAGATGCTAATACCGTATAACAGAGAAAACCGCCTGGTTTTCTTTTAAAAGATGGCTCTGCTATCACTTCTGGATGGACCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCGATGATGCGTAGCCGACCTGAGAGGGTAATCGG
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Información técnica (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Manuales de uso de kits (1)
Folletos y guías (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Pediococcus acidilactici, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Pediococcus pentosaceus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Pediococcus acidilactici facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Pediococcus pentosaceus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Pediococcus acidilactici and elevate your work to new heights.