dPCR Microbial DNA Detection Assay for Campylobacter jejuni

GeneGlobe ID: DMA00850 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay
Alternative names of species: Vibrio coli, Campylobacter coli, Campylobacter lari
dPCR wet-lab validated
Product name​
Campylobacter jejuni
GeneGlobe Cat.No. (Assay ID)​
DMA00850
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Campylobacter lari (201)
Campylobacter laridis
Campylobacter jejuni (197)
Campylobacter fetus subsp. jejuni
Vibrio hepaticus
Vibrio jejuni
Campylobacter coli (195)
Campylobacter hyoilei
Vibrio coli
Taxonomy​
Bacteria
Application field​
Food Testing
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Additional assay information​
Assay based on proven sequences of mericon qPCR system
Region of Interest​
CTGCTTAACACAAGTTGAGTAGGGAAAGTTTTTCGGTGTAGGATGAGACTATATAGTATCAGCTAGTTGGTAAGGTAATGGCTTACCAAGGCTATGACGCTTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTAGGGAATATTGCGCAATGGGGGAAACCCTGACGCAGCAACGCCGCGTGGAGGATGACACTTTTCGGAGCGTAAACTCCTTTTCTTAGGG
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technische Informationen (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit-Handbücher (1)
Broschüren und Leitfäden (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Campylobacter jejuni, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Campylobacter lari models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Campylobacter jejuni facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Campylobacter lari studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Campylobacter jejuni and elevate your work to new heights.