GeneGlobe ID: DMA00777 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Erysiphe necator (Qol-sensitive containing wt G143 allele)

Select a variant to see the price

Product Specification

Fungi detection assay
Alternative names of species: Erysiphe necator var. necator, Uncinula necator var. Necator oder Oidium tuckeri, Echter Mehltau
dPCR wet-lab validated
Product name​
Erysiphe necator (Qol-sensitive containing wt G143 allele)
GeneGlobe Cat.No. (Assay ID)​
DMA00777
Target type​
Microbial Id
Target region​
cytB
Target (NCBI taxonomy ID)​
Erysiphe necator (52586)
grape powdery mildew
Uncinula necator
Template accession​
NC_056146.1
Taxonomy​
Plants and Fungi
Application field​
Food production
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
CAGCATTCTTGGGTTATGTTTTACCCTACGGGCAGATGAGCCTATGGGGTGCAACCGTTAAGTAGGTAATAGCGGTTGAAAAATATCACTATATGCTGGAAACTTCTAAAGCTTTAAGTAGGTGCGG
Reaction size​
200rxns

Resources

Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Erysiphe necator (Qol-sensitive containing wt G143 allele), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Erysiphe necator models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Erysiphe necator (Qol-sensitive containing wt G143 allele) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Erysiphe necator studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Erysiphe necator (Qol-sensitive containing wt G143 allele) and elevate your work to new heights.