dPCR Microbial DNA Detection Assay for Fusarium culmorum

GeneGlobe ID: DMA00826 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

One tube with lyophilized assay, dye (fluorophore) configurable, 200 reactions (40 µl reaction in Nanoplate 26k)

Product Specification

Fungi detection assay
Alternative names of species: Fusisporium culmorum, Fusarium sp. Fcul7
dPCR wet-lab validated
Product name​
Fusarium culmorum
GeneGlobe Cat.No. (Assay ID)​
DMA00826
Target type​
Microbial Id
Target region​
elongation factor EF1α
Target (NCBI taxonomy ID)​
Fusarium culmorum (5516)
Fusisporium culmorum
Template accession​
AF212462
Taxonomy​
Plants and Fungi
Application field​
Food Production
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
AAGTCGACCACTGTGAGTACCACTGCATCCCAACCCCGCCGATACTTGGCGGGGTAGTTTCAAATTTCCAATGTGCTGACATACTTTGATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGT
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 103.04 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Fusarium culmorum, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Fusarium culmorum models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Fusarium culmorum facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Fusarium culmorum studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Fusarium culmorum and elevate your work to new heights.