dPCR Microbial DNA Detection Assay for Enterobacter cloacae (1)

GeneGlobe ID: DMA00134 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
Product name​
Enterobacter cloacae (1)
GeneGlobe Cat.No. (Assay ID)​
DMA00134
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Enterobacter cloacae (550)
Aerobacter cloacae
Bacillus cloacae
Bacterium cloacae
Cloaca cloacae
Template accession​
FJ194527.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Klebsiella oxytoca (571)
Bacillus oxytocus perniciosus
Pantoea agglomerans (549)
Bacillus milletiae
Bacterium herbicola
Enterobacter agglomerans
Erwinia herbicola
Erwinia milletiae
Pantoea herbicola
Pseudomonas herbicola
Klebsiella pneumoniae (573)
Bacillus pneumoniae
Bacterium pneumoniae crouposae
Hyalococcus pneumoniae
'Klebsiella aerogenes' (Kruse) Taylor et al. 1956
Klebsiella pneumoniae aerogenes
Klebsiella michiganensis (1134687)
Klebsiella granulomatis (39824)
Calymmatobacterium granulomatis
Donovania granulomatis
Encapsulatus inguinalis
Klebsiella variicola (244366)
Klebsiella singaporensis
Serratia marcescens (615)
Bacillus marcescens
Serratia marcescens subsp. marcescens
Serratia marcescens subsp. sakuensis
Enterobacter ludwigii (299767)
Klebsiella aerogenes (548)
Aerobacter aerogenes
Enterobacter aerogenes
Klebsiella mobilis
Enterobacter hormaechei (158836)
CDC Enteric Group 75
Enterobacter hormaechei O'Hara et al. 1990
Citrobacter farmeri (67824)
Citrobacter amalonaticus biogroup 1
Citrobacter genomospecies 4
Kosakonia oryzendophytica (1005665)
Enterobacter oryzendophyticus Hardoim et al. 2015
Application field​
Infectious Diseases
Wastewater & Drinking Water Epidemiology
Multiple Drug Resistance
Wet-lab tested in singleplex​
Yes, tested dye - Cy5
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
ACGGTAGCACAGAGAGCTTGCTCTCGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTG
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 250.89 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
seo_BottomDescription