dPCR Microbial DNA Detection Assay for Pediococcus damnosus

GeneGlobe ID: DMA00389 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the ribosomal protein L2P (rplB) gene
Product name​
Pediococcus damnosus
GeneGlobe Cat.No. (Assay ID)​
DMA00389
Target type​
Microbial Id
Target region​
Ribosomal protein L2P (rplB) gene
Target (NCBI taxonomy ID)​
Pediococcus damnosus (51663)
Template accession​
EU331293.1
Taxonomy​
Bacteria
Application field​
Food Production
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GACGATGTTGCTGCAACAGTTAAAGCTATCGAATATGATCCAAATCGAACTGCTAATATCGCCTTAATTGGTTACGATGATGGTACTAAAGCATATATCATTGCACCAAAAGGATTGAAGGTTGGAGA
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Informations techniques (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Manuels de kit (1)
Brochures et guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Pediococcus damnosus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Pediococcus damnosus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Pediococcus damnosus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Pediococcus damnosus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Pediococcus damnosus and elevate your work to new heights.