dPCR Microbial DNA Detection Assay for Clostridioides difficile
GeneGlobe ID: DMA00107 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
Alternative names of species: Clostridium difficile
dPCR wet-lab verified
Alternative names of species: Clostridium difficile
dPCR wet-lab verified
Product name
Clostridioides difficile
GeneGlobe Cat.No. (Assay ID)
DMA00107
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Clostridioides difficile (1496)
Clostridium difficile (Hall and O'Toole 1935) Prevot 1938 (Approved Lists 1980)
Peptoclostridium difficile
Clostridium difficile (Hall and O'Toole 1935) Prevot 1938 (Approved Lists 1980)
Peptoclostridium difficile
Template accession
NZ_ABKJ02000039.1
Taxonomy
Bacteria
Application field
Multiple Drug Resistance
Sepsis
Infectious Diseases
Wastewater & Drinking Water Epidemiology
Sepsis
Infectious Diseases
Wastewater & Drinking Water Epidemiology
Wet-lab tested in singleplex
Yes, tested dye - HEX
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
CCTTGGTAAGCCGTTACCTTACCAACTAGCTAATCAGACGCGGGTCCATCCTGTACTGGCTCACCTTTGATATTCAAGAGATGCCTCTCAAATATATTATCCCGTATTAGCATACCTTTCGGTATG
Reaction size
200rxns
Product Resources
File Size: 255.13 KBLanguage: English
Resources
Available Product Catalog (2)
Brochures and Guides (2)
Kit Handbooks (1)
Protocols (3)
Scientific Posters (1)
Technical Information (1)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Clostridioides difficile, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Clostridioides difficile models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Clostridioides difficile facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Clostridioides difficile studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Clostridioides difficile and elevate your work to new heights.