dPCR Microbial DNA Detection Assay for Human alphaherpesvirus 2

GeneGlobe ID: DMA00396 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay targeting the envelope glycoprotein G gene
Alternative names of species: Herpes simplex virus type 2
Product name​
Human alphaherpesvirus 2
GeneGlobe Cat.No. (Assay ID)​
DMA00396
Target type​
Microbial Id
Target region​
Glycoprotein G gene
Target (NCBI taxonomy ID)​
Human alphaherpesvirus 2 (10310)
Herpes simplex virus 2
Herpes simplex virus II
Herpes simplex virus (type 2)
Herpes simplex virus type 2
Herpes simplex virus type 2 (HSV-2)
herpes simplex virus type 2 HSV-2
HSV2
Human herpesvirus 2
hsv-ii
Template accession​
AJ303204.1
Taxonomy​
Viruses
Application field​
Human Pathogens
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
ATGCACGCCATCGCTCCCAGGTTGCTTCTTCTTTTTGTTCTTTCTGGTCTTCCGGGGACACGCGGCGGGTCGGGTGTCCCCGGACCAATTAATCCCCCCAACAACGATGTTGTTTTCCCGGGAGGTTCCCCCGTGGCTCAATATTGTTATGCCTATCCCCGGTTGGACGATCCCGGGCCC
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Human alphaherpesvirus 2, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Human alphaherpesvirus 2 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Human alphaherpesvirus 2 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Human alphaherpesvirus 2 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Human alphaherpesvirus 2 and elevate your work to new heights.