dPCR Microbial DNA Detection Assay for ACC-1 Group

GeneGlobe ID: DMA00531 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Resistance gene detection assay targeting the bacterial cephalosporin-hydrolyzing class C beta-lactamase ACC-1 gene
dPCR wet-lab verified
Product name​
ACC-1 Group
GeneGlobe Cat.No. (Assay ID)​
DMA00531
Target type​
Antibiotics Resistance
Target region​
Bacterial cephalosporin-hydrolyzing class C beta-lactamase ACC-1 gene
Target (NCBI taxonomy ID)​
Class C beta-lactamase
Template accession​
AJ133121
Taxonomy​
Resistance Genes
Secondary targets/specificity​
ACC-1
ACC-2
ACC-4
Application field​
Beta-lactam Resistance
Antibiotic Resistance (AMR)
Multiple Drug Resistance
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GGCGATGACGAAAAGCGTGGCTACGCCGATTGTTCCGCCGTTACCGCCACAGGAAAATGTGTGGATTAATAAGACCGGATCAACTAACGGCTTCGGTGCCTATATTGCGTTTGTTCCTGCTAAGAAGATGGGGATCGTGATGCTGGCTAACAAAAACTACT
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 238.4 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for ACC-1 Group, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Class C beta-lactamase models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for ACC-1 Group facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Class C beta-lactamase studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for ACC-1 Group and elevate your work to new heights.