dPCR Microbial DNA Detection Assay for oprj

GeneGlobe ID: DMA00572 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Resistance gene detection assay targeting the bacterial multidrug efflux transporter outer membrane subunit OprJ gene
dPCR wet-lab verified
Product name​
oprj
GeneGlobe Cat.No. (Assay ID)​
DMA00572
Target type​
Antibiotics Resistance
Target region​
Bacterial multidrug efflux transporter outer membrane subunit OprJ gene
Target (NCBI taxonomy ID)​
Multidrug resistance efflux pump
Template accession​
AE004091.2
Taxonomy​
Resistance Genes
Application field​
Drug Efflux Pump
Antibiotic Resistance (AMR)
Multiple Drug Resistance
Wet-lab tested in singleplex​
Yes, tested dye - HEX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
AGCAACACCAGCGCGTTGAATGCCTGCTGTTTCTGCCGCAGGTTGCGCTCCTGCTCGGCGCGCGCCTGCTCCACCAGGCCAAGGGCTTCCTGGTAGTCCAGCGCGGTGGCGGC
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 263.42 KBLanguage: English

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for oprj, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Multidrug resistance efflux pump models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for oprj facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Multidrug resistance efflux pump studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for oprj and elevate your work to new heights.