dPCR Microbial DNA Detection Assay for Leishmania spp._Pan
GeneGlobe ID: DMA00771 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Parasite detection assay
Alternative names of species: Leishmania donovani, Leishmania infantum, Leishmania major
dPCR wet-lab verified
Alternative names of species: Leishmania donovani, Leishmania infantum, Leishmania major
dPCR wet-lab verified
Product name
Leishmania spp._Pan
GeneGlobe Cat.No. (Assay ID)
DMA00771
Target type
Microbial Id
Target region
mkDNA
Target (NCBI taxonomy ID)
Leishmania (5658)
Template accession
Z35272.1
Taxonomy
Invertebrates
Application field
Tropical & Vector-borne Diseases
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
AAACTTTTCTGGTCCTCCGGGTAGGGGCGTTCTGCGAAAACCGAAAAATGGGTGCAGAAATCCCGTTCAAAAAATGGCTGAAAATGCCGAAAATCGGCTCCGGGGCGGGAAACTGGGGGTTGGTGTAAAATAGGGCCGGGTGGT
Reaction size
200rxns
Product Resources
File Size: 92.84 KBLanguage: English
Resources
Available Product Catalog (2)
Brochures and Guides (2)
Kit Handbooks (1)
Protocols (3)
Scientific Posters (1)
Technical Information (1)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Leishmania spp._Pan, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Leishmania models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Leishmania spp._Pan facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Leishmania studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Leishmania spp._Pan and elevate your work to new heights.