dPCR Microbial DNA Detection Assay for Necator americanus

GeneGlobe ID: DMA00470 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Metazoa detection assay targeting the ITS ribosomal RNA gene
Product name​
Necator americanus
GeneGlobe Cat.No. (Assay ID)​
DMA00470
Target type​
Microbial Id
Target region​
ITS ribosomal RNA gene
Target (NCBI taxonomy ID)​
Necator americanus (51031)
New World hookworm
Template accession​
MH665844.1
Taxonomy​
Invertebrates
Application field​
Human Pathogens
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
ATCAGGAAACCTTAATGATCCTTCACATGTTAACCAATAATGCGCGCTACGTGTTATGGTGGATGGGACAATATGTGTGGACGCCAACACAAAATATTAACTTTTTACATTTGATGTTTGCAGATGATCGTGACTTCATCTT
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Necator americanus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Necator americanus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Necator americanus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Necator americanus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Necator americanus and elevate your work to new heights.