dPCR Microbial DNA Detection Assay for Saccharomyces cerevisiae

GeneGlobe ID: DMA00758 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Yeast detection assay
Alternative names of species: Mycoderma cerevisiae Desm., 1827, Saccharomyces sp. Af145-1-1
dPCR wet-lab verified
Product name​
Saccharomyces cerevisiae
GeneGlobe Cat.No. (Assay ID)​
DMA00758
Target type​
Microbial Id
Target region​
Golgi transport complex subunit COG6
Target (NCBI taxonomy ID)​
Saccharomyces cerevisiae (4932)
baker's yeast
brewer's yeast
Candida robusta
Mycoderma cerevisiae
Saccharomyces capensis
Saccharomyces cerevisiae 'var. diastaticus'
Saccharomyces diastaticus
Saccharomyces italicus
Saccharomyces oviformis
Saccharomyces uvarum var. melibiosus
Template accession​
CP080616.1
Taxonomy​
Plants and Fungi
Application field​
Food Production
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
ATCGTCCTGAATTCCCTTTCTCTCGAACATAACTCTGTAAAGTTTCAGCAGCCTCACAATCTCGAAATTGATGATCGGATTTTCTTCAAACCTCACGATTTGCTCGATACGAATACGACACGAATTGGATAGCGACTGGATGATATCGTTCAGCAATTTGTTGTCGATGCCTTTCAAGAATGTC
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 89.3 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Saccharomyces cerevisiae, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Saccharomyces cerevisiae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Saccharomyces cerevisiae facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Saccharomyces cerevisiae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Saccharomyces cerevisiae and elevate your work to new heights.