dPCR Microbial DNA Detection Assay for Betapolyomavirus hominis, (BKV)

GeneGlobe ID: DMA00894 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay
Alternative names of species: Human polyomavirus 1, BK polyomavirus, BK virus, BK virus BKV, Human polyomavirus (type BK), Human polyomavirus BK, Human polyomavirus BKV, Papovavirus BKV, human polyomavirus type BK BKV, polyomavirus BK, BKPyV
dPCR wet-lab verified
Product name​
Betapolyomavirus hominis, (BKV)
GeneGlobe Cat.No. (Assay ID)​
DMA00894
Target type​
Microbial Id
Target region​
Target (NCBI taxonomy ID)​
Betapolyomavirus hominis (1891762)
BK polyomavirus
BKV
BK virus BKV
BK virus
Human polyomavirus 1
Human polyomavirus BK
Human polyomavirus BKV
human polyomavirus type BK BKV
Human polyomavirus (type BK)
Papovavirus BKV
polyomavirus BK
Polyomavirus hominis 1
Template accession​
KT896312.1
Taxonomy​
Viruses
Application field​
Human Pathogens
Transplantation
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
AACTTCACAAGAATTGCAAAGAAGAACAGAGAGATTCTTTAGAGACTCCTTGGCTAGATTTTTGGAAGAAACTACCTGGACAATTGTAAATGCCCCTGTAAACTTTTATAATTATATTCAAGAATATTATTCTGATCTTTCCCCTATTAGGCCCTCAATGGTTAGACAAGTTGC
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Betapolyomavirus hominis, (BKV), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Betapolyomavirus hominis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Betapolyomavirus hominis, (BKV) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Betapolyomavirus hominis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Betapolyomavirus hominis, (BKV) and elevate your work to new heights.