dPCR Microbial DNA Detection Assay for Klebsiella pneumoniae

GeneGlobe ID: DMA00367 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the glycerol dehydratase large subunit (gldA) gene
dPCR wet-lab validated
Product name​
Klebsiella pneumoniae
GeneGlobe Cat.No. (Assay ID)​
DMA00367
Target type​
Microbial Id
Target region​
Glycerol dehydratase large subunit (gldA) gene
Target (NCBI taxonomy ID)​
Klebsiella pneumoniae (573)
Bacillus pneumoniae
Bacterium pneumoniae crouposae
Hyalococcus pneumoniae
'Klebsiella aerogenes' (Kruse) Taylor et al. 1956
Klebsiella pneumoniae aerogenes
Template accession​
DQ191044.1
Taxonomy​
Bacteria
Application field​
Human Pathogens
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - ROX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
CTTTGAGGATATCGCCAGCAATATTCTCAATATGCTGCGCCAGCGGATCACCGGCGATTACCTGCAGACCTCGGCCATTCTCGATCGGCAGTTCGAGGTGGTGAGTGCGGTCAACGACATCAATGACTATCAGGGGCCGGGCACC
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 271.05 KBLanguage: English

Resources

Available Product Catalog (2)
Información técnica (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Manuales de uso de kits (1)
Folletos y guías (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Klebsiella pneumoniae, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Klebsiella pneumoniae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Klebsiella pneumoniae facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Klebsiella pneumoniae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Klebsiella pneumoniae and elevate your work to new heights.