dPCR Microbial DNA Detection Assay for Latilactobacillus curvatus

GeneGlobe ID: DMA00384 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the phenylalanyl-tRNA synthase alpha subunit (pheS) gene
Alternative names of species: Lactobacillus curvatus
Product name​
Latilactobacillus curvatus
GeneGlobe Cat.No. (Assay ID)​
DMA00384
Target type​
Microbial Id
Target region​
Phenylalanyl-tRNA synthase alpha subunit (pheS) gene
Target (NCBI taxonomy ID)​
Latilactobacillus curvatus (28038)
Bacterium curvatum
Lactobacillus curvatus
Template accession​
AM284232.1
Taxonomy​
Bacteria
Application field​
Probiotics
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TTCTATCAAATGGAAGGCCAAGTGATTGATAAAAACATTACAATGGCAGACTTAAAGGGAACCTTAGAATACACGATTCACCATATTTTTGGTGAAGACCGTGATTTACGTTTCCG
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Informations techniques (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Manuels de kit (1)
Brochures et guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Latilactobacillus curvatus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Latilactobacillus curvatus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Latilactobacillus curvatus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Latilactobacillus curvatus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Latilactobacillus curvatus and elevate your work to new heights.