Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab verified
Product name
Escherichia coli
GeneGlobe Cat.No. (Assay ID)
DMA00140
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Escherichia coli (562)
Bacillus coli
Bacterium coli commune
Bacterium coli
E. coli
Enterococcus coli
Escherichia/Shigella coli
Template accession
NC_008258.1
Secondary targets/specificity
Shigella dysenteriae (622)
Bacillus dysenteriae
Bacillus dysentericus
Bacillus shigae
Eberthella dysenteriae
Escherichia/Shigella dysenteriae
Shigella shigae
Shigella boydii (621)
Escherichia fergusonii (564)
CDC Enteric Group 10
Escherichia/Shigella fergusonii
Serratia marcescens (615)
Bacillus marcescens
Serratia marcescens subsp. marcescens
Serratia marcescens subsp. sakuensis
Shigella sonnei (624)
Bacterium sonnei
Enterobacter cloacae (550)
Aerobacter cloacae
Bacillus cloacae
Bacterium cloacae
Cloaca cloacae
Shigella flexneri (623)
Escherichia flexneri
Escherichia/Shigella flexneri
Shigella paradysenteriae
Klebsiella aerogenes (548)
Aerobacter aerogenes
Enterobacter aerogenes
Klebsiella mobilis
Escherichia albertii (208962)
Escherichia/Shigella albertii
Application field
Human Microbiome
Wastewater & Drinking Water Epidemiology
Wet-lab tested in singleplex
Yes, tested dye - ROX
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
GGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCA