dPCR Microbial DNA Detection Assay for Sarocladium strictum

GeneGlobe ID: DMA00476 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Fungal detection assay targeting the 28S ribosomal RNA gene
dPCR wet-lab verified
Product name​
Sarocladium strictum
GeneGlobe Cat.No. (Assay ID)​
DMA00476
Target type​
Microbial Id
Target region​
28S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Sarocladium strictum (5046)
Acremonium strictum
Sarocladium strictum (W. Gams) Summerbell 2011
Template accession​
GU219468.1
Taxonomy​
Plants and Fungi
Secondary targets/specificity​
Eurotiomycetes DC474 (1585412)
Aspergillus ustus (40382)
Sterigmatocystis ustus
Aspergillus nidulans (162425)
Aspergillus nidulellus
Emericella nidulans
Sterigmatocystis nidulans
Aspergillus terreus (33178)
Aspergillus terrestris
Aspergillus silvaticus (176179)
Aspergillus sylvaticus
Aspergillus heterothallicus (41742)
Emericella heterothallica
Aspergillus elongatus (41748)
Aspergillus sydowii (75750)
Sterigmatocystis sydowii
Application field​
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - ROX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
No
Region of Interest​
GAGCGGAACGACCACGCCGTAAAACACCCAATTTTTTAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCACGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCTTTCCGAG
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 258.6 KBLanguage: English

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Sarocladium strictum, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Eurotiomycetes DC474 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Sarocladium strictum facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Eurotiomycetes DC474 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Sarocladium strictum and elevate your work to new heights.