dPCR Microbial DNA Detection Assay for Fusarium solani

GeneGlobe ID: DMA00479 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Fungal detection assay targeting the beta tubulin gene
Product name​
Fusarium solani
GeneGlobe Cat.No. (Assay ID)​
DMA00479
Target type​
Microbial Id
Target region​
Beta tubulin gene
Target (NCBI taxonomy ID)​
Fusarium solani (169388)
Fusarium solani (Mart.) Sacc., 1881
Fusisporium solani
Neocosmospora solani
Template accession​
KU938964.1
Taxonomy​
Plants and Fungi
Secondary targets/specificity​
Beauveria bassiana (176275)
Beauveria bassiana var. bassiana
Botrytis bassiana
Cordyceps bassiana
Penicillium bassianum
Spicaria bassiana
Tritirachium shiotae
Fusarium falciforme (195108)
Acremonium falciforme
Cephalosporium falciforme
Neocosmospora falciformis
Fusarium udum (42665)
Gibberella indica
Fusarium oxysporum (5507)
Fusarium oxysporum Schltdl., 1824
Application field​
Environmental Microbes
Infectious Diseases
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
No
Region of Interest​
GACCGGTCAGTGCGTAAGTATCGCGACGCCTATTTCGCTGGCAGGATGCTCATAATCCGTAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGCCTCGACAGCAATGGTGTTTACAACGGCACCTCGGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATATTGCCCGAAGCCTACACCAAATCTAGCTGACA
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Fusarium solani, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Beauveria bassiana models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Fusarium solani facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Beauveria bassiana studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Fusarium solani and elevate your work to new heights.