dPCR Microbial DNA Detection Assay for Cucumber mosaic virus

GeneGlobe ID: DMA00865 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay
Alternative names of species: cucumber mosaic cucumovirus, CMV
dPCR wet-lab verified
Product name​
Cucumber mosaic virus
GeneGlobe Cat.No. (Assay ID)​
DMA00865
Target type​
Microbial Id
Target region​
Capsid protein (CP) gene
Target (NCBI taxonomy ID)​
Cucumber mosaic virus (12305)
CMV
cucumber mosaic cucumovirus CMV
cucumber mosaic cucumovirus
cucumber mosaic virus CMV
cucumber mosaic virus, CMV
Template accession​
MH119176.1
Taxonomy​
Viruses
Application field​
Food Testing
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
TGGTCGTCCCACTCTTAACCACCCAACCTTCGTGGGTAGTGAAAGCTGTAAACCCGGTTACACTTTCACATCTATTACCCTGAAACCGCCTGAAATTGAAAAAGGTTCATATTTTGGTAGAAGGTTGTCTTTGCCAGATTCAGTCACGGACTATGATAAGAAGCTTGTTTCGCGCATTCAAATCAGGATTAATCCTTTGCCGAAATTTGATTCTACCGTGTGGGTTACAGTTCGGAAAGTACCTTCATCATCCGATCTCTCCGTCGCCGCCATCTCTGCTATGTTTGGCGATGGTAACTCA
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Cucumber mosaic virus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Cucumber mosaic virus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Cucumber mosaic virus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Cucumber mosaic virus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Cucumber mosaic virus and elevate your work to new heights.