QiagenGeneGlobe
Custom Products Analyze Knowledge Services
Biological Knowledge
Genes
microRNAs
Pathways
Tools
Assay Wizard
Oligo Tools
Panel Finder
NGS Sequencing Tools
Get to Know GeneGlobe
Video Tutorials
What's new
Events and Webinars
Unlock Deeper Insights with GeneGlobe Tutorials
Unlock Deeper Insights with GeneGlobe Tutorials
Explore intuitive guides and resources designed to help you get the most out of GeneGlobe. Whether you're designing assays, browsing curated panels, or diving into analysis tools—find practical help to accelerate your research journey.
Check this out!
icon_0009_cart-s Cart icon_0071_person-s My Account
null
null
Comparable downregulation by endogenous miRNA and miScript miRNA Mimic.
Downregulation at protein level after miR-1 mimic transfection.
miScript miRNA Mimic stable for 72 hours.

Syn-hsa-miR-886-3p miScript miRNA Mimic

GeneGlobe ID: MSY0004906 | Cat. No.: 219600 | miScript miRNA Mimics

Product Specification

icon_0124_cc_gen_document-s

Product specification not yet available

We’re still working on finalizing the specifications for this product. In the meantime, our technical specialists are happy to help with any questions or details you need.

Need More Details?

Contact Us
targets mature miRNA: hsa-miR-886-3p MIMAT0004906: 5 'CGCGGGUGCUUACUGACCCUU

Resources

Safety Data Sheets (1)
Safety Data Sheets
Kit Handbooks (2)
(EN) Guidelines for miRNA mimic and miRNA inhibitor experiments
PDF (404KB)
(EN) - Guidelines for experiments using miScript Target Protectors
PDF (518KB)
For miRNA function research
Brochures & Guides (2)
microRNA Sample and Assay Technologies (eBook)
Total RNA Discovery - (EN)
HTML (255KB)
Simultaneously profile mRNA, miRNA and lncRNA using a simple, complete workflow
miRNA Research (1)
Technical guidelines for microRNA research
PDF (2MB)
Certificates of Analysis (1)
Certificates of Analysis
seo_BottomDescription
Country and Language
Contact us
Sample to Insight
© QIAGEN 2013–26. All rights reserved
Privacy PolicyTrademarks and DisclaimersImpressum