dPCR Microbial DNA Detection Assay for Bacillus licheniformis

GeneGlobe ID: DMA00042 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab verified
Product name​
Bacillus licheniformis
GeneGlobe Cat.No. (Assay ID)​
DMA00042
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Bacillus licheniformis (1402)
Clostridium licheniforme
Denitrobacillus licheniformis
Template accession​
AY479984.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Bacillus paralicheniformis (1648923)
Bacillus sonorensis (119858)
Bacillus haynesii (1925021)
Bacillus aerius (293388)
Application field​
Food Production
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGCTTGATTGAACCGCATGGTTCAATTATAAAAGGTGGCTTTTAGCTACCACTTACAGATGGACCCGCGGCGCATTA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 250.45 KBLanguage: English

Resources

Available Product Catalog (2)
Certificates of Analysis (1)
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Introducing the dPCR Microbial DNA Detection Assay for Bacillus licheniformis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Bacillus paralicheniformis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Bacillus licheniformis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Bacillus paralicheniformis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Bacillus licheniformis and elevate your work to new heights.