dPCR Microbial DNA Detection Assay for invA

GeneGlobe ID: DMA00642 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Virulence gene detection assay targeting the bacterial type III secretion system export apparatus protein InvA gene
dPCR wet-lab verified
Product name​
invA
GeneGlobe Cat.No. (Assay ID)​
DMA00642
Target type​
Virulence
Target region​
Bacterial type III secretion system export apparatus protein InvA gene
Target (NCBI taxonomy ID)​
invasion protein
Template accession​
CP002614.1
Taxonomy​
Virulence Genes
Application field​
Microbial Virulence
Wet-lab tested in singleplex​
Yes, tested dye - ROX
Wet-lab tested in multiplex​
Yes
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GGCATCCGCATCAATAATACCGGCCTTCAAATCGGCATCAATACTCATCTGTTTACCGGGCATACCATCCAGAGAAAATCGGGCCGCGACTTCCGCGACACGTTCTGAACCTTTGGTAATAACGATAAACTGGACCACGGTGACAATAGAGAAGA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 256.5 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for invA, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with invasion protein models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for invA facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for invasion protein studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for invA and elevate your work to new heights.