dPCR Microbial DNA Detection Assay for Mycobacteroides chelonae (2)

GeneGlobe ID: DMA00417 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the porin precursor gene
Alternative names of species: Mycobacterium chelonae
Product name​
Mycobacteroides chelonae (2)
GeneGlobe Cat.No. (Assay ID)​
DMA00417
Target type​
Microbial Id
Target region​
Porin precursor gene
Target (NCBI taxonomy ID)​
Mycobacteroides chelonae (1774)
Mycobacterium chelonei
Template accession​
FJ981589.1
Taxonomy​
Bacteria
Application field​
Wastewater & Drinking Water Epidemiology
Infectious Diseases
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TTACCCCTGGTCGCTGGGTGTGGGGTTGAACTTCAACTACACGACCCCCAATACCTCGATTCTTTACGGTATTCCGAACGCCTTCGGTGGTGGTCCTGAGGCTTCGTACATTCAGACCACCAACCTGTTGCCTTCGGCGGGTATCA
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Informations techniques (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Manuels de kit (1)
Brochures et guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Mycobacteroides chelonae (2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Mycobacteroides chelonae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Mycobacteroides chelonae (2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Mycobacteroides chelonae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Mycobacteroides chelonae (2) and elevate your work to new heights.