dPCR Microbial DNA Detection Assay for Clostridium botulinum

GeneGlobe ID: DMA00849 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

One tube with lyophilized assay, dye (fluorophore) configurable, 200 reactions (40 µl reaction in Nanoplate 26k)

Product Specification

Bacterial detection assay
Alternative names of species: Bacillus botulinus, Botulobacillus botulinus, Ermengemillus botulinus
dPCR wet-lab validated
Product name​
Clostridium botulinum
GeneGlobe Cat.No. (Assay ID)​
DMA00849
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Clostridium botulinum (1491)
Bacillus botulinus
Bacillus putrificus
Botulobacillus botulinus
Clostridium putrificum
Ermengemillus botulinus
Pacinia putrifica
Template accession​
X68171.1
Taxonomy​
Bacteria
Application field​
Food Testing
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
GCAGGAGAGGAAAGTGGAATTCCTAGTGTAGCGGTGAAATGCGTAGATATTAGGAAGAACACCAGTGGCGAAGGCGACTTTCTGGACTGTAACTGACACTGAGGCTCGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAATACTAGGTGTAGG
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Clostridium botulinum, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Clostridium botulinum models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Clostridium botulinum facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Clostridium botulinum studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Clostridium botulinum and elevate your work to new heights.