dPCR Microbial DNA Detection Assay for Streptomyces griseus

GeneGlobe ID: DMA00325 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name​
Streptomyces griseus
GeneGlobe Cat.No. (Assay ID)​
DMA00325
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Streptomyces griseus (1911)
Actinomyces griseus
Actinomyces setonii
Streptomyces cavourensis subsp. washingtonensis
Streptomyces setonii
Template accession​
EF571001.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Streptomyces microflavus (1919)
Actinomyces cretaceus
Actinomyces fulvissimus
Actinomyces lipmanii
Actinomyces microflavus
Actinomyces willmorei
Micromonospora microflava
Oospora cretacea
Streptomyces cretaceus
Streptomyces fulvissimus
Streptomyces griseus subsp. alpha
Streptomyces griseus subsp. cretosus
Streptomyces lipmanii
Streptomyces willmorei
Streptomyces finlayi (67296)
Actinomyces finlayi
Streptomyces pratensis (1169025)
Streptomyces phylogroup pratensis
Streptomyces anulatus (1892)
Actinomyces annulatus
Actinomyces citreofluorescens
Actinomyces fluorescens
Actinomyces Streptothrix annulatus
Streptomyces annulatus
Streptomyces chrysomallus subsp. chrysomallus
Streptomyces chrysomallus
Streptomyces citreofluorescens
Streptomyces citrifluorescens
Streptomyces fluorescens
Streptomyces parvus (66428)
Actinomyces parvus
Nocardia parva
Streptomyces mediolani (68237)
Streptomyces mediolanensis
Application field​
Environmental Microbes
Biocontrol
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GCCCTGGAAACGGGGTCTAATACCGGATAACACTCTGTCCCGCATGGGACGGGGTTAAAAGCTCCGGCGGTGAAGGATGAGCCCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGACGACGGGTAGCCGG
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Información técnica (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Manuales de uso de kits (1)
Folletos y guías (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Streptomyces griseus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Streptomyces finlayi models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Streptomyces griseus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Streptomyces finlayi studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Streptomyces griseus and elevate your work to new heights.