dPCR Microbial DNA Detection Assay for Moraxella catarrhalis

GeneGlobe ID: DMA00213 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
Product name​
Moraxella catarrhalis
GeneGlobe Cat.No. (Assay ID)​
DMA00213
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Moraxella catarrhalis (480)
Branhamella catarrhalis
Mikrokkokus catarrhalis
Moraxella (subgen. Branhamella Catlin 1970) catarrhalis (Frosch and Kolle 1896) Bovre 1984
Template accession​
NR_028669.1
Taxonomy​
Bacteria
Application field​
Human Pathogens
Wet-lab tested in singleplex​
Yes, tested dye - TAMRA
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
CAGGCTTAACACATGCAAGTCGAACGAAGTTAGGAAGCTTGCTTCTGATACTTAGTGGCGGACGGGTGAGTAATGCTTAGGAATCTGCCTAGTAGTGGGGGATAACTTGGGGAAACCCAAGCTAATACCGCATACGACCTACGGGTGAAAGGGGGCTTTTAGCTCTCGCTATTAGATGAGCCTAAGTCGGATTAGCTGGTTGGTGGGGTA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 235.11 KBLanguage: English

Resources

Available Product Catalog (2)
Technische Informationen (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit-Handbücher (1)
Broschüren und Leitfäden (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Moraxella catarrhalis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Moraxella catarrhalis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Moraxella catarrhalis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Moraxella catarrhalis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Moraxella catarrhalis and elevate your work to new heights.