dPCR Microbial DNA Detection Assay for Neisseria lactamica
GeneGlobe ID: DMA00230 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name
Neisseria lactamica
GeneGlobe Cat.No. (Assay ID)
DMA00230
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Neisseria lactamica (486)
Neisseria lactamicus
Neisseria lactamicus
Template accession
NZ_ACEQ01000095.1
Taxonomy
Bacteria
Application field
Human Microbiome
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
TAATCAGATATCGGCCGCTCGGATAGCGCAAGGCCCGAAGGTCCCCTGCTTTCTTCCTCAGAAAATATGCGGTATTAGCTGATCTTTCGATCAGTTATCCCCCACTGCCCGGTACGTTCCGATATGTTACTCAC
Reaction size
200rxns
Resources
Available Product Catalog (2)
Protocolos de inicio rápido (1)
Notas de aplicación (2)
Información técnica (1)
Manuales de uso de kits (1)
Carteles científicos (1)
Folletos y guías (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Neisseria lactamica, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Neisseria lactamica models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Neisseria lactamica facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Neisseria lactamica studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Neisseria lactamica and elevate your work to new heights.