dPCR Microbial DNA Detection Assay for Herpes simplex virus type 1

GeneGlobe ID: DMA00724 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay
Alternative names of species: HSV1
dPCR wet-lab validated
Product name​
Herpes simplex virus type 1
GeneGlobe Cat.No. (Assay ID)​
DMA00724
Target type​
Microbial Id
Target region​
US4
Target (NCBI taxonomy ID)​
Human alphaherpesvirus 1 strain 17 (10299)
Herpes simplex virus (type 1 / strain 17)
Human alphaherpesvirus 1 (10298)
herpes simplex virus 1 HSV-1
Herpes simplex virus 1
herpes simplex virus HSV-1
Herpes simplex virus type 1
herpes simplex virus type 1 HSV-1
herpes simplex virus type 1 HSV1
herpes simplex virus type-1 HSV-1
HSV-1
HSV1
Human herpesvirus 1
Human herpesvirus type 1
hsv-i
HHV-1
HHV1
Template accession​
NC_001806
Taxonomy​
Viruses
Application field​
Sexually Transmitted Infections (STI)
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
Yes
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
CCCTCGCATGAAGCCCCCAACATGACCCAGACCGGCACCACCGACTCTCCCACCGCCATCAGCCTTACCACGCCCGACCACACACCCCCCATG
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 115.81 KBLanguage: English

Resources

Available Product Catalog (2)
기술 정보 (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
키트 안내서 (1)
브로셔 및 가이드 (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Herpes simplex virus type 1, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Human alphaherpesvirus 1 strain 17 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Herpes simplex virus type 1 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Human alphaherpesvirus 1 strain 17 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Herpes simplex virus type 1 and elevate your work to new heights.