dPCR CNV Probe Gene of Interest for Hk2

GeneGlobe ID: DCG0000607 | Cat. No.: 250210 | dPCR CNV Probe Assays

Single tube containing ready-to-use, 20x-concentrated gene-specific assay; sufficient for 300/500/1000 dPCR reactions of 12 µl each

Product Specification

Gene symbol: Hk2
Ensembl Gene ID: ENSMUSG00000000628
dPCR wet-lab validated
Product Name​
dPCR CNV Probe Gene of Interest for Hk2
GeneGlobe Cat.No. (Assay ID)​
DCG0000607
Assay type​
Gene of Interest
Species​
Human (Homo sapiens)
Gene symbol​
Hk2
Ensembl Gene ID​
ENSMUSG00000000628
NCBI Gene Id​
15277
Strand​
Binds to reverse (3’ to 5’) bottom genome strand
Amplicon length​
94
Amplicon region​
ACCAAAAGAGTTGTGATCCAGCCTTGAAATTAGCTAACTACACCTGCACAGAAACTCTCAAGCCAGCAAAAGGGTCATCACCACTAATCTAGAAACTAAGCACTAAACCCTCTTTGGAGTGGCT
Recommended Reference Assay​
TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)
Recommended Restriction Enzyme​
PvuII, EcoRI, CviQI, HaeIII
Wet-lab verified​
dPCR wet-lab verified
Hydrolysis Probe​
FAM, ATTO550, Cy5, ATTO700
Primer Purification​
Desalted
Probe Purification​
HPLC
Reaction size​
300rxns, 500rxns and 1000rxns depending on selected dye

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 238.5 KBLanguage: English

Resources

Available Product Catalog (2)
Application Notes (1)
Here, we present a workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, which accelerate and streamline high-throughput analyses of target copy numbers in cultured cells. The workflow starts with detecting and sorting defined populations of cells as well as individual cells using cellenONE, followed by multiplexing dPCR on the QIAcuity platform. Copy number variations of target regions are then analyzed using the QIAcuity Software Suite, providing an intuitive and fast interpretation of results.
Quick-Start Protocols (1)
Brochures & Guides (1)
For locus-specific copy number variation (CNV) analysis using the QIAcuity Digital PCR System
Safety Data Sheets (1)
Certificates of Analysis (1)
seo_BottomDescription