GeneGlobe ID: DMA00488 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Human rotavirus A

Product Specification

Viral detection assay targeting the protease-sensitive protein (VP4) gene
dPCR wet-lab validated
Product name​
Human rotavirus A
GeneGlobe Cat.No. (Assay ID)​
DMA00488
Target type​
Microbial Id
Target region​
Protease-sensitive protein (VP4) gene
Target (NCBI taxonomy ID)​
Human rotavirus A (10941)
Human group A rotavirus
Template accession​
MH456963.1
Taxonomy​
Viruses
Application field​
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - Cy5
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
No
Region of Interest​
TTAGAAACATGGTGTATGTTAGATCATTAGCAGCTAATTTAAATTCAGTGAAATGTACAGGCGGAAGTTATGACTTTACACTACCAGTAGGTGCATGGCCAGTTATGAATGGGGGTGCTGTTTCTTTGCATTTTGCTGGAGTTACTTTATCCACACAATTCACTGACT
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 193.54 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Human rotavirus A, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Human rotavirus A models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Human rotavirus A facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Human rotavirus A studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Human rotavirus A and elevate your work to new heights.