GeneGlobe ID: DMA00136 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Enterococcus faecalis (1)

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
Product name​
Enterococcus faecalis (1)
GeneGlobe Cat.No. (Assay ID)​
DMA00136
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Enterococcus faecalis (1351)
Enterococcus proteiformis
Enterocoque
Micrococcus ovalis
Micrococcus zymogenes
Streptococcus faecalis
Streptococcus glycerinaceus
Streptococcus liquefaciens
Template accession​
NZ_ACGM01000106.1
Taxonomy​
Bacteria
Application field​
Probiotics
Wastewater & Drinking Water Epidemiology
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - HEX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GCCTTTCACTCTTATGCCATGCGGCATAAACTGTTATGCGGTATTAGCACCTGTTTCCAAGTGTTATCCCCCTCTGATGGGTAGGTTACCCACGTGTTACTCACCCGTCCGCCACTCCTCTTTCCAATTGAGTGCAAGCACTCGGGAGGAAAGAAGCGTTCGACTTGCATGTATTAGGCA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 248.12 KBLanguage: English

Resources

Available Product Catalog (2)
Technische Informationen (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit-Handbücher (1)
Broschüren und Leitfäden (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Enterococcus faecalis (1), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Enterococcus faecalis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Enterococcus faecalis (1) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Enterococcus faecalis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Enterococcus faecalis (1) and elevate your work to new heights.