dPCR Microbial DNA Detection Assay for Mycobacteroides chelonae (2)
GeneGlobe ID: DMA00417 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Bacterial detection assay targeting the porin precursor gene
Alternative names of species: Mycobacterium chelonae
Alternative names of species: Mycobacterium chelonae
Product name
Mycobacteroides chelonae (2)
GeneGlobe Cat.No. (Assay ID)
DMA00417
Target type
Microbial Id
Target region
Porin precursor gene
Target (NCBI taxonomy ID)
Mycobacteroides chelonae (1774)
Mycobacterium chelonei
Mycobacterium chelonei
Template accession
FJ981589.1
Taxonomy
Bacteria
Application field
Wastewater & Drinking Water Epidemiology
Infectious Diseases
Infectious Diseases
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
TTACCCCTGGTCGCTGGGTGTGGGGTTGAACTTCAACTACACGACCCCCAATACCTCGATTCTTTACGGTATTCCGAACGCCTTCGGTGGTGGTCCTGAGGCTTCGTACATTCAGACCACCAACCTGTTGCCTTCGGCGGGTATCA
Reaction size
200rxns
Resources
Available Product Catalog (2)
빠른 시작 프로토콜 (1)
애플리케이션 노트 (2)
기술 정보 (1)
키트 안내서 (1)
과학 포스터 (1)
브로셔 및 가이드 (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Mycobacteroides chelonae (2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Mycobacteroides chelonae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Mycobacteroides chelonae (2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Mycobacteroides chelonae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Mycobacteroides chelonae (2) and elevate your work to new heights.