dPCR Microbial DNA Detection Assay for Eubacterium rectale

GeneGlobe ID: DMA00143 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
Product name​
Eubacterium rectale
GeneGlobe Cat.No. (Assay ID)​
DMA00143
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Agathobacter rectalis (39491)
Eubacterium rectale (Hauduroy et al. 1937) Prevot 1938 (Approved Lists 1980)
Pseudobacterium rectale
Roseburia rectale
Template accession​
GQ898750.1
Taxonomy​
Bacteria
Application field​
Human Microbiome
Wet-lab tested in singleplex​
Yes, tested dye - HEX
Wet-lab tested in multiplex​
Yes
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
CGTAAACGATGAATACTAGGTGTTGGGAAGCATTGCTTCTCGGTGCCGTCGCAAACGCAGTAAGTATTCCACCTGGGGAGTACGTTCGCAAGAATGAAACTCAAAGGAATTGACGGGGACCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCAAGTCTTGACATCCTTCTGACCGGTACTTAACCGTACCTTCTCTTCGGAGCAGGAGTGACAGGTGGTGCA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 259.26 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Eubacterium rectale, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Agathobacter rectalis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Eubacterium rectale facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Agathobacter rectalis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Eubacterium rectale and elevate your work to new heights.