dPCR Microbial DNA Detection Assay for ipaH

GeneGlobe ID: DMA00643 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Virulence gene detection assay targeting the bacterial invasion plasmid antigen ipaH gene
Product name​
ipaH
GeneGlobe Cat.No. (Assay ID)​
DMA00643
Target type​
Virulence
Target region​
Bacterial invasion plasmid antigen ipaH gene
Target (NCBI taxonomy ID)​
ipaH
Template accession​
HE616529.1
Taxonomy​
Virulence Genes
Application field​
Microbial Virulence
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GCAGCGACCTGTTCACGGAATCCGGAGGTATTGCGTGCAGAGACGGTATCGGAAAGGCGGTCAAGGAACGCGGAAAAGGTGTTGGCATGCTCTT
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Información técnica (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Manuales de uso de kits (1)
Folletos y guías (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for ipaH, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with ipaH models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for ipaH facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for ipaH studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for ipaH and elevate your work to new heights.