dPCR Microbial DNA Detection Assay for Escherichia coli (rfbE)

GeneGlobe ID: DMA00699 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the GDP-perosamine synthase RFbE/PerA gene
Product name​
Escherichia coli (rfbE)
GeneGlobe Cat.No. (Assay ID)​
DMA00699
Target type​
Microbial Id
Target region​
GDP-perosamine synthase RFbE/PerA gene
Target (NCBI taxonomy ID)​
Escherichia coli (562)
Bacillus coli
Bacterium coli commune
Bacterium coli
E. coli
Enterococcus coli
Escherichia/Shigella coli
Template accession​
CP038425.1
Taxonomy​
Bacteria
Application field​
Human Microbiome
Wastewater & Drinking Water Epidemiology
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
No
Additional assay information​
Assay based on proven sequences of mericon qPCR system
Region of Interest​
GAAAGTAAAGATGTTTTTCACACTTATTGGATGGTCTCAATTCTAACTAGGACCGCAGAGGAAAGAGAGGAATTAAGGAATCACCTTGCAGATAAACTCATCGAAACAAGGCCAGTTTT
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Información técnica (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Manuales de uso de kits (1)
Folletos y guías (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Escherichia coli (rfbE), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Escherichia coli models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Escherichia coli (rfbE) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Escherichia coli studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Escherichia coli (rfbE) and elevate your work to new heights.