dPCR Microbial DNA Detection Assay for Human orthorubulavirus 2

GeneGlobe ID: DMA00376 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay targeting the hemagglutinin-neuraminidase (HN) gene
Alternative names of species: Human parainfluenza 2
dPCR wet-lab validated
Product name​
Human orthorubulavirus 2
GeneGlobe Cat.No. (Assay ID)​
DMA00376
Target type​
Microbial Id
Target region​
Hemagglutinin-neuraminidase (HN) gene
Target (NCBI taxonomy ID)​
Human orthorubulavirus 2 (2560525)
HPIV-2
HPIV2
Human parainfluenza 2 virus
Human parainfluenza virus 2
Human parainfluenza virus type 2
Human rubulavirus 2
Parainfluenza virus type 2
PIV-2
Template accession​
HM460888.1
Taxonomy​
Viruses
Application field​
Human Pathogens
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - ROX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
CAACAATCTGCTGCGGCATTTCCAATCTTCAGGACTATGAAAACCATTTACCTAAGTGATGGAATCAATCGCAAAAGCTGTTCAGTCACTGCTATACCAGGAGGTTGTGTCTTGTACTGT
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 256.06 KBLanguage: English

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Human orthorubulavirus 2, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Human orthorubulavirus 2 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Human orthorubulavirus 2 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Human orthorubulavirus 2 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Human orthorubulavirus 2 and elevate your work to new heights.