dPCR Microbial DNA Detection Assay for Lachancea thermotolerans

GeneGlobe ID: DMA00799 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Yeast detection assay
Alternative names of species: Zygosaccharomyces thermotolerans, Kluyveromyces thermotolerans
dPCR wet-lab verified
Product name​
Lachancea thermotolerans
GeneGlobe Cat.No. (Assay ID)​
DMA00799
Target type​
Microbial Id
Target (NCBI taxonomy ID)​
Lachancea thermotolerans (381046)
Kluyveromyces thermotolerans
Zygosaccharomyces thermotolerans
Template accession​
NR_111334.1
Taxonomy​
Plants and Fungi
Application field​
Food Production
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
TTTGTTAGAGCAGCCGGGAAGTTCAGAAGCCTGCGCTTGATTGCGCGGCCGATGATGCTTTCTGTTAACGACTGTCTCTCTACACACACACTGTGGAGTAATTTATTTTACAACGCTTCTTCTTTGGGCTTTACGGCCCAAGGGTTACAAACACAAACAACTATTGTATTTTAAACACTGTCAATTATTTTTCATTTTAGAAAAAAAATATTTAAA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 90.88 KBLanguage: English

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
seo_BottomDescription