dPCR Microbial DNA Detection Assay for Torulaspora delbrueckii

GeneGlobe ID: DMA00805 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Yeast detection assay
Alternative names of species: Saccharomyces delbrueckii, Torulaspora sp. R3DFM2
dPCR wet-lab validated
Product name​
Torulaspora delbrueckii
GeneGlobe Cat.No. (Assay ID)​
DMA00805
Target type​
Microbial Id
Target (NCBI taxonomy ID)​
Torulaspora delbrueckii (4950)
Candida colliculosa
Saccharomyces delbrueckii
Saccharomyces fermentati
Saccharomyces rosei
Torulaspora delbrueckii (Lindner) Lindner 1904
Template accession​
NR_111257.1
Taxonomy​
Plants and Fungi
Application field​
Food Production
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, CviQI
Template present in Microbial DNA Positive Control​
No
Region of Interest​
AATCTATATGAATGAAGTTAGAGGACGTCTAAAGATACTGTAAGAGAGGATCAGGTTCAAGACCAGCGCTTAATTGCGCGGTTGCGGCTTGGTTCGCCTTTTGCGGAACATGTCTTTTCTCGTTGTTAACTCTACTTCAACTTCTACAACACTGTGGAGTTTTCTACACAACTTTTCTTCTTTGGGAAGATACGTCTTGTGCGTGCTTCCCAGAGGTGACAAACACA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 91.32 KBLanguage: English

Resources

Available Product Catalog (2)
기술 정보 (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
키트 안내서 (1)
브로셔 및 가이드 (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Torulaspora delbrueckii, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Torulaspora delbrueckii models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Torulaspora delbrueckii facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Torulaspora delbrueckii studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Torulaspora delbrueckii and elevate your work to new heights.