dPCR Microbial DNA Detection Assay for Orthomarburgvirus marburgense Pan (2/2)

GeneGlobe ID: DMA00875 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Viral detection assay. For full pan coverage use in one reaction with DMA00874, both assays labelled with same fluorophore
Alternative names of species: Marburg marburgvirus, Lake Victoria marburgvirus, Marburg virus MBG
dPCR wet-lab verified
Product name​
Orthomarburgvirus marburgense Pan (2/2)
GeneGlobe Cat.No. (Assay ID)​
DMA00875
Target type​
Microbial Id
Target (NCBI taxonomy ID)​
Orthomarburgvirus marburgense (3052505)
Lake Victoria marburgvirus
Marburg marburgvirus
Marburg virus MBG
MBG
Template accession​
EF446132.1 (CI67)
Taxonomy​
Viruses
Application field​
Human Pathogens
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI, PvuII, XbaI, AluI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
AAAAGTTGCTGATTCCCCTTTGGAGGCATCCAAGCGATGGGCTTTCAGGACAGGTGTACCTCCCAAGAATGTTGAGTATACAGAAGGGGAGGAA
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Orthomarburgvirus marburgense Pan (2/2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Orthomarburgvirus marburgense models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Orthomarburgvirus marburgense Pan (2/2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Orthomarburgvirus marburgense studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Orthomarburgvirus marburgense Pan (2/2) and elevate your work to new heights.