dPCR Microbial DNA Detection Assay for Microsporum audouinii

GeneGlobe ID: DMA00460 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Fungal detection assay targeting the translation elongation factor 1-alpha (tef-1-alpha) gene
Product name​
Microsporum audouinii
GeneGlobe Cat.No. (Assay ID)​
DMA00460
Target type​
Microbial Id
Target region​
Translation elongation factor 1-alpha (tef-1-alpha) gene
Target (NCBI taxonomy ID)​
Microsporum audouinii (34393)
Closteroaleurosporia audouinii
Sabouraudites audouinii
Sporotrichum audouinii
Veronaia audouinii
Template accession​
KM678138.1
Taxonomy​
Plants and Fungi
Application field​
Human Microbiome
Infectious Diseases
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
GGCAAGAAGTCCTTCAAGTATGCCTGGGTTCTTGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATTGACATCGCCCTCTGGAAGTTCGAGACCCCCAAGTACATGGTCACCGTCATCGG
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Microsporum audouinii, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Microsporum audouinii models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Microsporum audouinii facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Microsporum audouinii studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Microsporum audouinii and elevate your work to new heights.