dPCR Microbial DNA Detection Assay for Saccharomyces Pan (2/2)

GeneGlobe ID: DMA00762 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

For full pan coverage use in one reaction with Saccharomyces Pan (1/2) DMA00761, both assays labelled with same fluorophore
dPCR wet-lab validated
Product name​
Saccharomyces Pan (2/2)
GeneGlobe Cat.No. (Assay ID)​
DMA00762
Target type​
Microbial Id
Target region​
ch14
Target (NCBI taxonomy ID)​
Saccharomyces (4930)
Pachytichospora
Template accession​
CP046094.1
Taxonomy​
Plants and Fungi
Application field​
Food Production
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
PvuII, XbaI, CviQI, HaeII
Template present in Microbial DNA Positive Control​
No
Region of Interest​
GCAGCCTCACAATCTCGAAATTGATGATCGGATTTTCTTCAAACCTCACGATTTGCTCGATACGAATACGACACGAATTGGATAGCGACTGGATGATATCGTTCAGCAATTTGTTGTCGATGCCTTTCAAGAATGTCTTGTTTTGTTGAAGTATAGAAATTGGGGTATCTTTTAAGTCTTCATCCTGAAAGTCAAATAGTGACTTCACGAAATCAGCTTCATTTGCGATGATGGAATGAACGGACGCTAGTACGTCACCAATATACCTAATTGGATCGTGTGCCGATAATATGATGGGTTTAGAGGTAGTTGAATTCATATCGAATTGAGACAAAAACTCATCCAGAATACTCTTGGATCTCAGTGTGGTCA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 79.38 KBLanguage: English

Resources

Available Product Catalog (2)
Información técnica (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Manuales de uso de kits (1)
Folletos y guías (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Saccharomyces Pan (2/2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Saccharomyces models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Saccharomyces Pan (2/2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Saccharomyces studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Saccharomyces Pan (2/2) and elevate your work to new heights.