Mirna Stemloop Summary
| id | hsa-mir-211 |
| Accession | MI0000287 |
| Comments | This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. The sequence maps to human chromosome 15. |
| Description | Homo sapiens miR-211 stem-loop |
| Gene Family | MIPF0000042;mir-204 |
| Genome Context | chr15: 31065032-31065141 [-] |
| miRna Matures Links | |
| Sequence | UCACCUGGCCAUGUGACUUGUGGGCUUCCCUUUGUCAUCCUUCGCCUAGGGCUCUGAGCAGGGCAGGGACAGCAAAGGGGUGCUCAGUUGUCACUUCCCACAGCACGGAG |