The following mature miRNA have the same seed sequence: CCAUCGA
| ID | hsa-miR-181a-3p |
| Accession | MIMAT0000270 |
| Sequence | 64 - ACCAUCGACCGUUGAUUGUACC - 85 |
| Seed Sequence | CCAUCGA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
binds
regulates
disease
- neoplasia
- rheumatoid arthritis
- colorectal cancer
- nonobstructive azoospermia
- chronic epilepsy
- pilocarpine-induced status epilepticus
- experimental autoimmune encephalomyelitis
- mammary neoplasm
- small cell lung cancer
role in cell
- activation in