The following mature miRNA have the same seed sequence: GGACCUG
| ID | hsa-miR-492 |
| Accession | MIMAT0002812 |
| Sequence | 30 - AGGACCUGCGGGACAAGAUUCUU - 52 |
| Seed Sequence | GGACCUG |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- TP53
- butein
disease
- colorectal cancer
- bladder neoplasm
- bladder neoplasia