The following mature miRNA have the same seed sequence: AACGCGC
| ID | hsa-miR-523-3p |
| Accession | MIMAT0002840 |
| Sequence | 53 - GAACGCGCUUCCCUAUAGAGGGU - 75 |
| Seed Sequence | AACGCGC |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulates
disease
- epithelial cancer
- hepatocellular carcinoma
- liver cancer
role in cell
- proliferation